Bulk RNA-Seq quantification in kallisto
Introduction
We previously showed that pooled single cell CPM was strongly correlated with bulk log TPM (but not log CPM/RPKM).
To understand why pooled CPM eQTL mapping appears much more difficult,
estimate log TPM for the iPSC bulk RNA-Seq using kallisto
File manifest
The data were deposited in GEO under accession GSE89895.
Get the mapping from samples to files.
| BioSample | Experiment | LoadDate | MBases | MBytes | ReleaseDate | Run | SRA_Sample | Sample_Name | Assay_Type | AvgSpotLen | BioProject | Center_Name | Consent | DATASTORE_filetype | DATASTORE_provider | InsertSize | Instrument | LibraryLayout | LibrarySelection | LibrarySource | Organism | Platform | SRA_Study | cell_type | source_name | title | | SAMN06020640 | SRX3452559 | 2017-12-08 | 4777 | 3322 | 2017-12-15 | SRR6355950 | SRS1802805 | GSM2392685 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18486 | | SAMN06020639 | SRX3452560 | 2017-12-26 | 1728 | 1179 | 2017-12-26 | SRR6355951 | SRS1802806 | GSM2392686 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18489 | | SAMN06020691 | SRX3452561 | 2017-12-08 | 3516 | 2343 | 2017-12-15 | SRR6355952 | SRS1802807 | GSM2392687 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18498 | | SAMN06020690 | SRX3452562 | 2017-12-08 | 4605 | 3062 | 2017-12-15 | SRR6355953 | SRS1802809 | GSM2392688 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18501 | | SAMN06020689 | SRX3452563 | 2017-12-08 | 3900 | 2597 | 2017-12-15 | SRR6355954 | SRS1802808 | GSM2392689 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18502 | | SAMN06020688 | SRX3452564 | 2017-12-08 | 685 | 382 | 2017-12-15 | SRR6355955 | SRS1802810 | GSM2392690 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18505 | | SAMN06020687 | SRX3452565 | 2017-12-26 | 3402 | 2337 | 2017-12-26 | SRR6355956 | SRS1802811 | GSM2392691 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18507 | | SAMN06020686 | SRX3452566 | 2017-12-26 | 4110 | 2807 | 2017-12-26 | SRR6355957 | SRS1802812 | GSM2392692 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18508 | | SAMN06020685 | SRX3452567 | 2017-12-08 | 832 | 468 | 2017-12-15 | SRR6355958 | SRS1802813 | GSM2392693 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18510 | | SAMN06020684 | SRX3452568 | 2017-12-08 | 1495 | 839 | 2017-12-15 | SRR6355959 | SRS1802814 | GSM2392694 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18511 | | SAMN06020683 | SRX3452569 | 2017-12-08 | 2891 | 1942 | 2017-12-15 | SRR6355960 | SRS1802815 | GSM2392695 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18517 | | SAMN06020682 | SRX3452570 | 2017-12-08 | 5092 | 3400 | 2017-12-15 | SRR6355961 | SRS1802816 | GSM2392696 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18519 | | SAMN06020681 | SRX3452571 | 2017-12-08 | 7683 | 5327 | 2017-12-15 | SRR6355962 | SRS1802817 | GSM2392697 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18520 | | SAMN06020680 | SRX3452572 | 2017-12-08 | 7461 | 5221 | 2017-12-15 | SRR6355963 | SRS1802818 | GSM2392698 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18522 | | SAMN06020679 | SRX3452573 | 2017-12-08 | 2906 | 1893 | 2017-12-15 | SRR6355964 | SRS1802819 | GSM2392699 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18852 | | SAMN06020678 | SRX3452574 | 2017-12-08 | 3202 | 2142 | 2017-12-15 | SRR6355965 | SRS1802820 | GSM2392700 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18853 | | SAMN06020677 | SRX3452575 | 2017-12-26 | 4154 | 2899 | 2017-12-26 | SRR6355966 | SRS1802821 | GSM2392701 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18855 | | SAMN06020676 | SRX3452576 | 2017-12-26 | 4122 | 2906 | 2017-12-26 | SRR6355967 | SRS1802822 | GSM2392702 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18856 | | SAMN06020675 | SRX3452577 | 2017-12-08 | 4716 | 3053 | 2017-12-15 | SRR6355968 | SRS1802824 | GSM2392703 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18858 | | SAMN06020674 | SRX3452578 | 2017-12-08 | 6313 | 4378 | 2017-12-15 | SRR6355969 | SRS1802823 | GSM2392704 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18859 | | SAMN06020673 | SRX3452579 | 2017-12-26 | 3910 | 2521 | 2017-12-26 | SRR6355970 | SRS1802827 | GSM2392705 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18861 | | SAMN06020672 | SRX3452580 | 2017-12-08 | 3787 | 2525 | 2017-12-15 | SRR6355971 | SRS1802825 | GSM2392706 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18862 | | SAMN06020671 | SRX3452581 | 2017-12-08 | 1020 | 575 | 2017-12-15 | SRR6355972 | SRS1802826 | GSM2392707 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18870 | | SAMN06020670 | SRX3452582 | 2017-12-08 | 3750 | 2522 | 2017-12-15 | SRR6355973 | SRS1802828 | GSM2392708 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18907 | | SAMN06020669 | SRX3452583 | 2017-12-08 | 1279 | 713 | 2017-12-15 | SRR6355974 | SRS1802833 | GSM2392709 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18912 | | SAMN06020668 | SRX3452584 | 2017-12-08 | 5057 | 3320 | 2017-12-15 | SRR6355975 | SRS1802832 | GSM2392710 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA18913 | | SAMN06020667 | SRX3452585 | 2017-12-08 | 9035 | 5880 | 2017-12-15 | SRR6355976 | SRS1802829 | GSM2392711 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19093 | | SAMN06020666 | SRX3452586 | 2017-12-26 | 2122 | 1442 | 2017-12-26 | SRR6355977 | SRS1802830 | GSM2392712 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19098 | | SAMN06020665 | SRX3452587 | 2017-12-08 | 1609 | 920 | 2017-12-15 | SRR6355978 | SRS1802831 | GSM2392713 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19099 | | SAMN06020664 | SRX3452588 | 2017-12-26 | 2777 | 1804 | 2017-12-26 | SRR6355979 | SRS1802834 | GSM2392714 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19101 | | SAMN06020663 | SRX3452589 | 2017-12-08 | 3984 | 2621 | 2017-12-15 | SRR6355980 | SRS1802836 | GSM2392715 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19102 | | SAMN06020662 | SRX3452590 | 2017-12-08 | 719 | 408 | 2017-12-15 | SRR6355981 | SRS1802835 | GSM2392716 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19108 | | SAMN06020661 | SRX3452591 | 2017-12-08 | 562 | 301 | 2017-12-15 | SRR6355982 | SRS1802837 | GSM2392717 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19114 | | SAMN06020660 | SRX3452592 | 2017-12-08 | 4131 | 2945 | 2017-12-15 | SRR6355983 | SRS1802838 | GSM2392718 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19116 | | SAMN06020659 | SRX3452593 | 2017-12-08 | 5158 | 3443 | 2017-12-15 | SRR6355984 | SRS1802839 | GSM2392719 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19119 | | SAMN06020658 | SRX3452594 | 2017-12-08 | 4047 | 2897 | 2017-12-15 | SRR6355985 | SRS1802840 | GSM2392720 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19127 | | SAMN06020657 | SRX3452595 | 2017-12-08 | 758 | 429 | 2017-12-15 | SRR6355986 | SRS1802841 | GSM2392721 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19128 | | SAMN06020656 | SRX3452596 | 2017-12-08 | 2909 | 1962 | 2017-12-15 | SRR6355987 | SRS1802842 | GSM2392722 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19130 | | SAMN06020655 | SRX3452597 | 2017-12-08 | 763 | 438 | 2017-12-15 | SRR6355988 | SRS1802843 | GSM2392723 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19138 | | SAMN06020654 | SRX3452598 | 2017-12-08 | 3254 | 2342 | 2017-12-15 | SRR6355989 | SRS1802846 | GSM2392724 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19140 | | SAMN06020653 | SRX3452599 | 2017-12-08 | 2939 | 1986 | 2017-12-15 | SRR6355990 | SRS1802844 | GSM2392725 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19143 | | SAMN06020652 | SRX3452600 | 2017-12-08 | 3215 | 2301 | 2017-12-15 | SRR6355991 | SRS1802845 | GSM2392726 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19144 | | SAMN06020651 | SRX3452601 | 2017-12-08 | 3187 | 2130 | 2017-12-15 | SRR6355992 | SRS1802851 | GSM2392727 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19152 | | SAMN06020650 | SRX3452602 | 2017-12-08 | 4138 | 2778 | 2017-12-15 | SRR6355993 | SRS1802848 | GSM2392728 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19153 | | SAMN06020649 | SRX3452603 | 2017-12-08 | 5082 | 3380 | 2017-12-15 | SRR6355994 | SRS1802849 | GSM2392729 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19159 | | SAMN06020648 | SRX3452604 | 2017-12-08 | 4789 | 3437 | 2017-12-15 | SRR6355995 | SRS1802847 | GSM2392730 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19160 | | SAMN06020647 | SRX3452605 | 2017-12-08 | 2984 | 1999 | 2017-12-15 | SRR6355996 | SRS1802850 | GSM2392731 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19190 | | SAMN06020646 | SRX3452606 | 2017-12-08 | 5594 | 3980 | 2017-12-15 | SRR6355997 | SRS1802854 | GSM2392732 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19192 | | SAMN06020645 | SRX3452607 | 2017-12-08 | 3053 | 2033 | 2017-12-15 | SRR6355998 | SRS1802852 | GSM2392733 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19193 | | SAMN06020644 | SRX3452608 | 2017-12-08 | 3290 | 2200 | 2017-12-15 | SRR6355999 | SRS1802853 | GSM2392734 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19204 | | SAMN06020643 | SRX3452609 | 2017-12-08 | 3832 | 2548 | 2017-12-15 | SRR6356000 | SRS1802859 | GSM2392735 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19206 | | SAMN06020642 | SRX3452610 | 2017-12-08 | 4932 | 3598 | 2017-12-15 | SRR6356001 | SRS1802856 | GSM2392736 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19207 | | SAMN06020641 | SRX3452611 | 2017-12-08 | 1720 | 932 | 2017-12-15 | SRR6356002 | SRS1802855 | GSM2392737 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19209 | | SAMN06020696 | SRX3452612 | 2017-12-08 | 5306 | 3879 | 2017-12-15 | SRR6356003 | SRS1802857 | GSM2392738 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19210 | | SAMN06020695 | SRX3452613 | 2017-12-08 | 1128 | 811 | 2017-12-15 | SRR6356004 | SRS1802858 | GSM2392739 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19225 | | SAMN06020694 | SRX3452614 | 2017-12-08 | 2963 | 1986 | 2017-12-15 | SRR6356005 | SRS1802860 | GSM2392740 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19238 | | SAMN06020693 | SRX3452615 | 2017-12-26 | 4332 | 3036 | 2017-12-26 | SRR6356006 | SRS1802862 | GSM2392741 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19239 | | SAMN06020692 | SRX3452616 | 2017-12-26 | 4555 | 3142 | 2017-12-26 | SRR6356007 | SRS1802861 | GSM2392742 | RNA-Seq | 50 | PRJNA420980 | GEO | public | sra | ncbi | 0 | Illumina HiSeq 2500 | SINGLE | cDNA | TRANSCRIPTOMIC | Homo sapiens | ILLUMINA | SRP126289 | Induced pluripotent stem cell | Induced pluripotent stem cell | NA19257 |
Build the index
We need to be careful and use exactly the same sequences which were used in the scRNA-Seq quantification.
sbatch --partition=broadwl #!/bin/bash curl -OL --ftp-pasv "ftp://ftp.ensembl.org/pub/release-75/fasta/homo_sapiens/cds/Homo_sapiens.GRCh37.75.cds.all.fa.gz"
Submitted batch job 44782550
srun --partition=broadwl --pty bash
srun: job 44825594 queued and waiting for resources srun: job 44825594 has been allocated resources echo 'org_babel_sh_eoe'
zcat Homo_sapiens.GRCh37.75.cds.all.fa.gz | head
zcat Homo_sapi ens.GRCh37.75.cds.all.fa.gz | head ENST00000415118 cds:known chromosome:GRCh37:14:22907539:22907546:1 gene:ENSG00000223997 gene_biotype:TR_D_gene transcript_biotype:TR_D_gene GAAATAGT ENST00000434970 cds:known chromosome:GRCh37:14:22907999:22908007:1 gene:ENSG00000237235 gene_biotype:TR_D_gene transcript_biotype:TR_D_gene CCTTCCTAC ENST00000448914 cds:known chromosome:GRCh37:14:22918105:22918117:1 gene:ENSG00000228985 gene_biotype:TR_D_gene transcript_biotype:TR_D_gene ACTGGGGGATACG ENST00000604642 cds:known chromosome:GRCh37:15:20209093:20209115:-1 gene:ENSG00000270961 gene_biotype:IG_D_gene transcript_biotype:IG_D_gene GTGGATATAGTGTCTACGATTAC ENST00000603326 cds:known chromosome:GRCh37:15:20210050:20210068:-1 gene:ENSG00000271317 gene_biotype:IG_D_gene transcript_biotype:IG_D_gene NNTGACTATGGTGCTAACTAC
zcat Homo_sapiens.GRCh37.75.cds.all.fa.gz | awk '{split($3, a, ":"); c=a[3]} c ~ /^([0-9][0-9]?|[XY]|MT)$/ && $5 == "gene_biotype:protein_coding" {k[$4] = 1} END {for (i in k) {n += 1} print n}'
3, a, ":"); c=a[3]} c ~ /^([0-9][0-9]?|[XY]|
MT)$/ && $5 == "gene_biotype:protein_coding" {k[$4] = 1} END {for (i in k) {n += 1} pri
nt n}'
20327
Build the index.
sbatch --partition=broadwl --mem=8G #!/bin/bash source activate scqtl kallisto index -i transcripts.idx /scratch/midway2/aksarkar/singlecell/run-kallisto/ensembl-75-protein-coding.fa.gz
Submitted batch job 44822034
Run kallisto
Download the data and run quantification.
sbatch --partition=broadwl --mem=5G --job-name kallisto -a 2-58 #!/bin/bash set -e source activate scqtl readarray tasks <metadata.txt task=(${tasks[$SLURM_ARRAY_TASK_ID]}) test -f ${task[1]}.fastq.gz || fastq-dump --gzip ${task[1]} kallisto quant --plaintext --single -l 200 -s 50 -i transcripts.idx -o ${task[-1]} ${task[1]}.fastq.gz gzip ${task[-1]}/abundance.tsv
Submitted batch job 44829590
Move the output to permanent storage.
test -e .rsync-filter || cat >.rsync-filter <<EOF + */ + abundance.tsv.gz - * EOF rsync -FFau /scratch/midway2/aksarkar/singlecell/run-kallisto/ /project2/mstephens/aksarkar/projects/singlecell-qtl/data/kallisto/
Process the output.
zcat Homo_sapiens.GRCh37.75.cds.all.fa.gz | awk '/^>/ {sub(">", "", $1); split($3, a, ":"); split($4, b, ":"); c=a[3]} c ~ /^([0-9][0-9]?|[XY]|MT)$/ && $5 == "gene_biotype:protein_coding" {print $1, b[2]}' >mapping.txt
sbatch --partition=broadwl #!/bin/bash set -e function process () { zcat $1 | awk -v ind=$(basename $(dirname $1)) 'BEGIN {while (getline <"mapping.txt") {m[$1] = $2}} NR > 1 {tpm[m[$1]] += $NF} END {for (gene in tpm) {print ind, gene, tpm[gene]}}' } export -f process find -name "abundance.tsv.gz" | parallel --halt now,fail=1 -j1 process | gzip >bulk-ipsc-tpm.txt.gz cp bulk-ipsc-tpm.txt.gz /project2/mstephens/aksarkar/projects/singlecell-qtl/data/kallisto/
Submitted batch job 44835137